The 82GHVMV and 141KSF Deletions in the Nsp1 Protein of ORF1ab Polyprotein Favour the Creation of Immune-Weak SARS-CoV-2

Journal: SunText Review of Virology

DOI: 10.51737/2766-5003.2023.037

Download PDF
Article Type: Research Article
Authors: Chakraborty AK
Keywords: Nsp1 protein; Genome deletion; Deletion boundary oligos; ORF1ab protein; ORF7a/b deletions; SARS-CoV-2

Abstract

The Wuhan corona virus was mutated and deleted at different positions of the genome specifically in deadly Alpha and Delta variants whereas spike protein was mostly affected in Omicron variants. The nsp1 protein (180 AAs) is the first protein of ORF1ab polyprotein which was degraded in host into sixteen (nsp1-nsp16) polypeptides with diverse functions. The most popular deletion was 3675SGF in the nsp6 domain which was first appeared in early 2021 in B.1.1.7, B.1.351 and B.1.1.28.1 variants but now carried into most Omicron variants. We investigated here the deletion in the nsp1 protein which interacted with many cellular proteins preventing viral clearance. A 141KSF three amino acids deletion in nsp1 was persistent in all Omicron BA.4 variant while another 82GHVMV five amino acids deletion was detected at the upstream of 141KSF in some recent isolates. BLAST-N search with 82GHVMV oligo gave no 141KSF deletion mutant but selection with GHVMV-KSF oligo gave all 82GHVMV plus 141KSF deletion mutants including 3675SGF (ORF1ab), 31ERS (N-protein), 24LPP (Spike) as well as 26nt 3’-UTR deletions. Sequences surrounding 82GHVMV and 141KSF deletions formed hairpin structures that were changed in deletion mutants and 3-D structure of mutant nsp1 was also changed. Previously, we showed the frequent deletions in ORF7a and ORF7b as well as termination codon mutations in ORF8 genes. In summary, we postulated that such changes might be favoured host from severe effects of those viral moderator proteins sustaining viral growth in same cells. On the contrary, absence of those small transacting proteins favoured the clearance of SARS-CoV-2 by host immune system generating mild infections.

Introduction

Corona virus infections claimed >600000 lives in two years recently and its genetic structure was known extensively due to worldwide sequencing efforts [1]. The SARS-CoV-2 is a large positive-stranded RNA virus with~30000 nucleotides genome and it was to MERS, SARS-CoV, CoV 229E etc. related human corona viruses that were known for long time [2-4]. It has structural proteins Membrane (M), Envelope (E), Nucleocapsid (N), Spike (S) coded from 3’-1/3 part of the virus independently but RNA-dependent RNA polymerase was coded from nsp12 domain of ORF1ab polyprotein from 2/3 of the 5’-part of the genome [5]. The ORF1ab polyprotein was degraded into sixteen polypeptides (nsp1-nsp16) (Figure-1). The ORF1ab generated sixteen peptides are: Nsp1(1-180aa), Nsp2(181-818aa), Nsp3(819-2763aa), Nsp4(2764-3263aa), Nsp5(3264-3569aa), Nsp6(3570-3859aa), Nsp7(3860-3942aa), Nsp8(3943-4140aa), Nsp9(4141-4253aa), Nsp10(4265-4392aa), Nsp11(4393-4400aa), Nsp12(4401-5324aa), Nsp13(5325-5925aa), Nsp14(5926-6462aa), Nsp15(6453-6798aa) and Nsp16(6799-7096aa). The nsp2 protein is RNA topoisomerase whereas Nsp3 and nsp5 are proteases and nsp12 is RNA-dependent RNA polymerase [6-9]. The nsp6, nsp7, nsp8, nsp9 and nsp10 were small accessory proteins involved in RNA polymerase replication complex [10-12]. The nsp14 and nsp15 are nucleases to degrade RNA and nsp16 is 2’-O Uridine methyltransferase and as well as nsp13 is RNA helicase with capping methyl transferase similarity [13-15]. Nsp11 is a small peptide and function was not known. The ORF3a, ORF6, ORF7a, ORF7b, ORF8, ORF9 and ORF10 small proteins also coded from 3’ end of the SARS-CoV-2 genome and have roles in regulating cellular genes [16-20]. Many drugs were discovered against proteases and RNA polymerases but vaccines (specifically recombinant spike vaccine) were only important remedy that halted the corona virus spread [21,22]. The most frequent mutation that occurred in most corona virus isolates was 3037C>T which is a synonymous change that usually accompanied 3 other mutations that include 241C>T, 14408C>T (P323L in RdRp) and 23403A>G (D614G in S-protein). The omicron corona virus (B.1.1.529) spike mutations were: A67V (V67), T95I (I93), N211I (I206), L212V (V207), V215P (P210), R216E (E211), G341D (D336), S373L (L368), S375P (P370), S377F (F372), K419N (N414), N442K (K437), G448S (S443), S479N (N474), E486A (A481), Q495R (R490), G498S (S493), Q500R (R495), Y507H (H502), T549K (K544), H657Y (Y652), P683H (H678), N766K (K761), D798Y (Y793), N858K (K853), Q956H (H951), N971K (K966), and L983F (F978) [in sate values for omicron virus positions [23-26]. Interestingly, N501Y dominant mutation in B.1.1.7 was found in omicron BA.1, BA.4 and BA.5 including other related variants like BQ.1 and BF.7. The nsp1 protein is 180 amino acids and such protein has deleted in some corona virus strains [27]. Recent data suggested that Nsp1 protein could inhibit all cellular antiviral defence mechanisms that would depend on the expression of host factors, interferon-gamma and IL-6 [28-32]. It was found that amino acid residues K164 and H165 of Nsp1 from both SARS-CoV and SARS-CoV-2 were necessary for ribosome interaction as revealed by Cryo–Electron Microscopy of in vitro–reconstituted various Nsp1-40S and Nsp1-80S complexes.  The Nsp1 C-terminus bound to mRNA tunnel inhibiting mRNA entry and protein synthesis blocking the retinoic acid inducible gene-I dependent innate immune responses that would otherwise facilitate clearance of the infection [33-36]. The SARS-CoV-2 escapes direct NK cell killing through Nsp1-mediated downregulation of ligands for NKG2D [37]. The mRNA degradation function of nsp1 protein was reported [38,39]. Further, nsp1 is a potent translational inhibitor [40,41]. The nsp1 protein also inhibits cellular mRNA synthesis and directs viral protein synthesis [42-44]. The deletions hotspot in the nsp1 protein are thus very interesting. We demonstrated in this article that 141KSF deletion in nsp1 protein was occurred in mostly omicron BA.4 variants whereas some deletion hotspot was located at 59 amino acids (AAs) upstream of 141KSF deletion site which we called 82GHVMV locus where 2-5 AAs deletions were found in some SARS-CoV-2 variants [45-47].

Methods

We searched PubMed to get idea on published papers on nsp1protein (www.ncbi.nlm.nih.gov/pubmed). The SARS-CoV-2 sequences were down loaded from SARS-CoV-2 database (NCBI, NIH, USA). We also searched NCBI BLAST search using BLAST-N and BLAST-X search methods to get sequences [48]. Multi-alignment of protein was done by MultAlin software and multi-alignment of DNA by CLUSTAL-Omega software, EMBL-EBI [49-51]. The ORF1ab mutants was obtained by BlastN search of deletion boundary of 60-100nt sequence and then analyzing the sequences with 95-100% similarities [52,53]. The other ORF1ab mutants were detected by Blast-N search and Blast-X search with selected deletion boundaries. Hairpin structure of ~ 120-200nt sequence was done by OligoAnalyzer 3.1 software (Integrated DNA Technologies). The protein 3-D structure was determined by SWISS-Model software with normal vs. mutant peptides [54-58].

Results

We made multi-alignment of coronavirus genomes to find specific deletions in the ORF1ab genes and few oligonucleotides at the deletion boundaries of 82GHVMV, 141KSF and 3675SGF deletions of ORF1ab protein as shown in (Table 1). The KSF deletion oligo (5’-tgg cca tag gta cgg cgc cga tct aga ctt agg cga cga gc ttg gca ctg a-3’), GHVMV deletion oligo (5’-acg ttc gga tgc tcg aac tgc acc tca tga gct ggt agc aga act cga agg cat t-3’) and SGF deletion oligo (5’-aat tac aga aga ggt tgg cca tag ttt gaa gct aaa aga ctg tgt tat gta tgc atc ag-3’) gave very informative on the ORF1ab deletion mutants (>5000 sequences) in the NCBI database. The GHVMV-KSF oligo gave >995 sequences with both 82GHVMV plus 141KSF deletion in the nsp1 protein. A 63nt deletion from nt. 27695-27768 at the junction of ORF7a gene 3’-end and ORF7b gene 5’-end was found in accession no. OM766944. A 26nt deletion at the 3’-UTR (nt. 29733-29759) of SARS-CoV-2 genome was found (5’-gag gcc acg cgg agt acg atc gag tg-3’) in different GHVMV mutants (accession numbers OP200462, BS004962, OX271963, ON956441, OP258049, ON414598, and ON766944) (Figure 2). We BLAST-N searched using SGF-1st and SGF-2nd oligos to trap 3675SGF deletion mutants and 10 sequences (five 1st SGF and five 2nd SGF) were aligned using NC_045512.2 as standard. We found that SGF 1st and 2nd deletion oligos selected sequences had all 3675SGF deletions (data not shown) but two sequences (acc. nos. OK040080 and OP591969) had 141KSF deletion whereas one (acc. no. OP827777) had 84VMV three AA deletion instead 82GHVMV (Figure 3A). The ratio of SGF: KSF: GHVMV deletions in ORF1ab protein estimated approximately 10:2:1. Isolated sequences were mostly Omicron corona virus variants with 31ERS N-protein deletion except accession numbers MZ223360 and OL369199, which had 69HV and 212L deletions but no 31EPS insertion and designated as pre-omicron BA.1 variant. Surprisingly, the sequence OK040080 had 31ERS deletion in N-protein and 141KSF deletion in ORF1ab whereas no 24LPP or 69HV deletions in spike indicating it was either BA.1/BA.2 or BA.4/BA.5 but omicron pre-BA.4. On the contrary, the sequence OP591969 had 141KSF deletion in ORF1ab and 24LPP plus 69HV deletions in spike and was omicron BA.4 variant (Figure 3B).


Table 1: Sequences of the deletion boundary oligonucleotides.

GHVMV-KSF oligo

 

5’-cgttcggatgctcgaactgcacctcatgagctggtagcagaactcgaaggcatt

cagtacggtcgtagtggtgagacacttggtgtccttgtccctcatgtgggcgaaat

accagtggcttaccgcaaggttcttcttcgtaagaacggtaataaaggagctggtg

gccataggtacggcgccgatctagacttaggcgacgagcttggcactgatcctt-3’

>1000

KSF oligo

5’-tggccataggtacggcgccgatctagacttaggcgacgagcttggcactga-3’

>5000

GHVMV oligo

5’-acgttcggatgctcgaactgcacctcatgagctggtagcagaactcgaaggcatt-3’

>5000

1st SGF oligo

5’-GACATGGTTGATACTAGTTTGAAGCTAAAAGACTGTGTTATGTAT-3’

>250

2nd SGF oligo

5’- GATATGGTTGATACTAGTTTGAAGCTAAAAGACTGTGTTATGTAT-3’

>10000


The sequences, OP619597, OP827932 and OP827059 had 24LPP and 69HV deletions but no 141KSF deletion in ORF1ab and were omicron BA.5 variants. The sequence ON999790 had 24LPP in spike but no 69HV deletion and was omicron BA.2 variant. This data confirmed the heterogeneous population of corona viruses in different 3675SGF deletion mutants which appeared early. Multi-alignment of GHVMV oligo selected eight sequences demonstrated all recent Omicron isolates with 3675SGF deletions but no 141KSF deletion (Figure 4A). The 24LPP and 69HV spike deletions suggested all were omicron corona virus (Figure 4B). Further, we aligned GHVMV-KSF deletion oligo selected sixteen sequences to show such sequences had both 82GHVMV plus 141KSF deletion in the nsp1 protein including 3675SGF (ORF1ab), 31ERS (N-protein), 24LPP (spike) and 26nt 3’UTR deletions (Figure 5A). Thus, mostly were omicron BA.4 sub-variants with 141KSF-deletion in ORF1ab gene and four were BA.2 variants (ON708747, ON800232, OW825883, and OW998170) those had 24LPP deletion but no 69HV deletion (Figure 5B). All sequences carried dominant N501Y and D614G non-sense point mutation in the spike as well as P4517L mutation in RdRp domain of ORF1ab polyprotein (data not shown). Interestingly, the ORF7a gene hotspot deletion and mutation sites were affected in the few GHVMV-KSF oligo selected Omicron corona viruses. Among them, a 112nt large deletion detected in accession number OP791818 at nucleotide position 27547. While 20nt deletion detected in accession number OP828357 at nucleotide 27546 and 12nt (5’-ttt act ctc caa-3’) deletion detected in accession number OX368044 at nucleotide 27679 while mere 3nt (5’-tac-3’) deletion detected in accession number OX369387 at nucleotide 27681 (data not shown). We multi-aligned different corona virus variants to demonstrate the spread of 82GHVMV, 141KSF and 3675SGF deletions in different variants with time (Figure 6A). Most viruses since early 2021 had 3675SGF deletion except most deadly Delta variant whereas 141KSF nsp1 deletion appeared in early 2022 in omicron BA.4 variants (Figure 6B). We performed the CLUSTAL-omega phylogenetic analysis to show relation among the sixteen different corona virus lineages to confirm Delta variant was unique sub-variant (Figure 6C). The COVID-19 B.1.617.2 and B.1.526 variants were closely related having no 3675SGF deletion in nsp6 protein. Similarly, BF.7, BK.1, BE.1.1 were related to BA.5 variant. Whereas B.1.1.7 (Alpha), B.1.351 (Beta) and B.1.1.28.1 (Gamma) were closely related with abundant 3675SGF deletion as reported earlier. Further, to conclude that 3675SGF deletion was not carried in Delta variant, we selected B.1.617.2 and AY.103 Delta corona virus sequences but did not detected any 82GHVMV, 141KSF and 3675SGF deletions (Figure 7). However, KSF deletion only happened in omicron BA.4 variants as we demonstrated earlier. Importantly, we detected one amino acid deletion in the omicron BA.1 and BA.1.1 variants at 2083S of ORF1ab polyprotein as demonstrated in (Figure 8A). We multi-aligned B.1.1.529, BA.1, BA.1.1, BA.1.1.2, BA.1.1.18 sub-variants sequences to conclude that 2083S deletion was indeed BA.1 variant specific (Figure 8B). In figure-9, we extensively showed the 141KSF deletion was associated with only omicron BA.4 variants. To trap the early date 3675SGF deletion, we aligned sequences from different countries to demonstrate that early 2021 was date time for appearance of such deletion when no KSF deletion was found (Figures 9-10).  Further we showed that the 2083Y deletion was found in omicron BA.1 variant only but not in omicron BA.2, BA.4 and BA.5 sub-variants as well as other deadly variants like Alpha, Beta and Delta variants (Figure 11). Further, we analysed the hairpin structures of ~250nt sequences surroundings 82GHVMV and 141KSF deletion sites. Demonstrated that special hairpin nob-like structure altered in 82GHVMV locus and a stiff long hairpin in 141KSF locus also slightly changed (Figure 12). Such hairpin structures may explain the reason of deletions involving recombination enzymes like RNA topoisomerase (nsp2) or other cellular recombination enzymes. We used MEGAV.11 software to align 14 nsp1 sequences and only one sequence was BA.4.1 variant with 141KSF deletion (Figure-13). The Seq15 was GHVMV-KSF oligo selected sequence whereas the Seq16 was GHVMV oligo selected sequence. A S135R mutation in nsp1 was found in Omicron variants (BA.2, BE.1.1, BF.7, BA.2.75.2, BA.4.1 and BA.5) but not in Alpha, Gamma or Delta variants. Interestingly, GHVMV oligo selected sequence (accession no. ON972497) has no such mutation but with GHVMV-KSF oligo selected one (accession no. OP200462) which was BA.4 variant. Model structure (SWISS-MODEL) of normal nsp1 protein and GHVMV-KSF deletion mutant suggested a profound change in 3-D residues although Ramachandran plot suggested 98.18% favoured in normal nsp1 protein over 98.1% in GHVMV-KSF deletion mutant (Figure 14). The Clash Score increased in mutant from 0.00 to 1.77 whereas Mol Probity Score change from 0.51 to 0.96 based on published nsp1 model structures (PDB: 7K3N and 6ZMI). We showed in figure-14 how in mutant nsp1 protein Proline 80 residue was hidden and Arginine 77 residue was protruded in deleted nsp1 protein. Likely such changes may lower the binding efficiency of nsp1 protein to human 80S ribosome complex to inhibit host protein synthesis.

Discussion

We clearly demonstrated that Delta corona virus variant has no 82GHVMV, 141KSF, 2083Y and 3675SGF deletions. Further we clearly showed that among the four deletions described, the SGF deletion was appeared first in B.1.1.7 during early 2021. Similarly, 2083Y, a single amino acid deletion was specific for Omicron BA.1 variant whereas KSF deletion was specific for omicron BA.4 variant and both were appeared in early, 2022. While deletion in the GHVMV locus was limited and only appeared in Omicron variants. The nsp1 is a hotspot of deletion and may be target drug design. We have clearly demonstrated the deletions and dominant point mutations in the ORF1ab gene that gave 7096 AA protein which on proteolysis produced 16 polypeptides (nsp1-nsp16) with diverse functions. In majority of corona virus population, the most frequent and common mutation like T265I (C1059T) in nsp2 RNA topoisomerase, P323L(C17747T) in RdRp, D614G (A23403G) in spike, Q57H (G25563T) in ORF3a and L84S (T28144C) in ORF8, were detected [59]. Khalid et al reported the insertion of TTT at 11085 creating one extra amino acid (F) to the NSP6 protein at amino acid position 38. The mutations and deletions were ubiquitous but analysis of 20 or more sequences sometime might give erroneous data and only desired portion of the multi-alignment data was presented [60]. The nsp6 protein has 7 putative trans-membrane helices and binds to TANK binding kinase 1 (TBK1) and suppresses the phosphorylation of interferon regulatory factor 3 (IRF3) thereby, lowering the Type I interferon response; to evade host defences. The point mutations were also important in different domains of ORF1ab polyproteins. The nsp13 RNA helicase-rRNA methyltransferase P504L and Y541C mutations were documented in samples before April, 2020 [61]. Different five mutations; T265I in nsp2, T1246I in nsp3 protease, G3278S in nsp5 proteinase, L3606F in nsp6 and P4715L in RdRp were found common in corona viruses analysed from six geographical locations; Africa, Asia, Europe, North America, Oceania and South America [24]. Other than SGF (3675-3677) deletion of nsp6, the F3760 and MVD (3669-3671) deletions were also reported. A YHFRELGVV (4738- 4746) deletion in the RNA dependent RNA polymerase or N389, GLNDNL (445-450), V649, T770, C784 deletions in the RNA topoisomerase were reported by same group [62]. Quite surprising 6 and 10 amino acids deletions were reported in spike protein at 365 and 679 positions respectively (accession nos. MT621560 and MT370992 respectively). Thus, deletion and point mutation in most RNA viruses were universal although we were unable to show such mutation in the RNA polymerase enzyme except P4715L. Importantly, recent Omicron virus 24LPP deletion in spike and 31ERS deletion in N-protein were very important in regulating COVID-19 immune-function and replication. We do not know the consequence of 26nt 3’-UTR deletion as we detected in many Omicron variants. It assumed then that such deletions might be lowering the SARS-CoV-2 overall pathogenicity. The Alpha variant N501Y mutation increased transmission and most importantly D614G mutation found in all variants since March, 2020 which made corona virus deadly. The Omicron corona virus 20-25 mutations over Wuhan corona virus in the RBD domain of spike absolutely gave COVID-19 immune-escape character and a repeated-infections even after 2-3 doses of vaccine intake were reported worldwide. If the nsp1 82GHVMV and 141KSF deletions in the nsp1 protein in Omicron variants has any relation to spike 24LPP or 31ERS N-protein deletions was not known [59]. Molecular modelling suggested that nsp1 deletions might have negative impact of its trans-activator or moderator function with host genes. Similarly, we do not know, why is the 2083Y deletion in nsp3 protease of Omicron corona virus was BA.1 variant specific?  Fisher et al. reported that 3675SGF deletion in nsp6 affected the virus replication machinery as reduced virus titre was found [31]. It appeared that 3675SGF deletion was not granted in Delta variants (AY.103, B.1.617.2) (figure-9 and figure-11). However, we found a popular corona virus Delta variant characteristic of 157FR two amino acids deletion in spike protein and 119DF deletion in the ORF8 protein (data not shown). The 3675GHVMV deletion in the nsp1 protein was found very limited with only few hundred in the database and 141KSF deletion in the same protein was very much abundant in Omicron BA.4. Variant and subvariants (figure-7 and figure-8). Sosnowski et al. demonstrated that conserved key residues in the amino-terminal half of the NSP1 protein were essential for evasion to the inhibitory effect of NSP1 on translation [43,47]. Fisher et al demonstrated the multifunctional role of nsp1 to shut off cellular protein synthesis, to degrade mRNAs and to block cellular interferon response [31]. We presumed a hairpin nob-like structures located at the nsp1 locus regulated such deletions (figure-14). Further, model structure clearly demonstrated the impact of such 8 AAs deletions in the nsp1 protein changing its overall 3-D structure. Taken together, we demonstrated the distribution of COVID-19 ORF1ab major deletions since December 2019 to December 2022 in different variant and sub variants which was never explored [63]. Most vivid example was, such deletion was not detected in Corona virus Delta variant which was impacted society in a horrible way with million deaths between May, 2021 to December, 2021. Surely, we have to explore the most recent BA.2.75, BA.4.6, BA.5.2.1, BF.7 and BE.1.1 lineages if any new deletion to appear changing epidemic spread of corona virus infections [64-65].

Acknowledgement

We thank CLUSTAL-Omega software for free distribution and NCBI (USA) for free SARS-CoV-2 Database usage worldwide. AKC is a retired professor of Biochemistry.

Competent interest

The author declares no conflict of interest. This paper uses only computer-generated data analysis using SARS-CoV-2 Database.

References

  1. Wu F, Zhao S, Yu B, Chen Y, Wang W, Hu Y, et al. Complete genome characterisation of a novel coronavirus associated with severe human respiratory disease in Wuhan, China. bioRxiv. 2020.
  2. Cui J, Li F, Shi ZL. Origin and evolution of pathogenic coronaviruses. Nat Rev Microbiol. 2019; 17: 181-192.
  3. Rota PA, Oberste MS, Monroe SS, Nix WA, Campagnoli R, Icenogle JP, et al. Characterization of a novel coronavirus associated with severe acute respiratory syndrome. Science. 2003; 300: 1394-1399.
  4. Rockx B, Kuiken T, Herfst S, Bestebroer T, Lamers MM, Meulder DD, et al. Comparative pathogenesis of COVID-19, MERS, and SARS in a nonhuman primate model. Science. 2020; 368: 1012-1015.
  5. Chakraborty AK, Chanda A. New Biotechnological Exploration on COVID-19 Proteins: Functions, Mutational Profiles and Molecular Targets for Drug Design. Sun Text Rev Virol. 2021; 2: 115.
  6. Chakraborty AK. Coronavirus Nsp2 Protein Homologies to the bacterial DNA Topoisomerase I and IV Suggest Nsp2 Protein is a unique RNA Topoisomerase with novel target for drug and vaccine development. Virol Mycol. 2020; 9: 185.
  7. Nguven TT, Pathirana PN, Abdelrazek M, Nguyen T, Creighton D, Nguyen ND, et al. Genomic mutations and changes in protein secondary structure and solvent accessibility of SARS-CoV-2. Scientific Reports, 2021; 11.
  8. Noske GD, Nakamura AM, Gawriljuk VO, Fernandes RS, Godoy AS, Oliva G, et al. A Crystallographic Snapshot of SARS-CoV-2 Main Protease Maturation Process. J Mol Biol. 2021; 433: 167118.
  9. Gao Y, Yan L, Huang Y, Liu F, Zhao Y, Cao L, et al. Structure of the RNA-dependent RNA polymerase from COVID-19 virus. Science, 2020; 368: 779-782.
  10. Benvenuto D, Angeletti S, Giovanetti M, Pascarella S, Cauda R, Ciccozzi M, et al. Evolutionary analysis of SARS-CoV-2: how mutation of Non-Structural Protein 6 (NSP6) could affect viral autophagy. J Infect. 2020; 81: e24-e27.
  11. Angelini MM, Akhlaghpour M, Neuman BW, Buchmeier MJ. Severe acute respiratory syndrome coronavirus non-structural proteins 3, 4, and 6 induce double-membrane vesicles. MBio. 2013; 4.
  12. Hassan SS, Choudhury PP, Dayhoff GW, Alaa AA, Uhal BD, Lundstrom K, et al. The importance of accessory protein variants in the pathogenicity of SARS-CoV-2. Arch Biochem Biophys. 2022; 717: 109124.
  13. Slanina H, Madhugiri R, Bylapudi G, Schultheib K, Karl N, Gulyaeva A, et al. Coronavirus replication–transcription complex: Vital and selective NMPylation of a conserved site in nsp9 by the NiRAN-RdRp subunit. Proc Natl Acad Sci. 2021; 118: e2022310118.  
  14. Chakraborty AK. Multi-Alignment comparison of Coronavirus non-structural proteins Nsp13-16 with ribosomal proteins and other DNA/RNA modifying enzymes suggested their roles in the regulation of host protein synthesis. Int J Clin Med Info. 2020; 3: 7-19.
  15. Chakraborty AK. Clinical, Diagnostic and Therapeutic implications of Coronavirus ORFab Polyprotein associated Nsp16 Protein-A bioinformatics approach. Acta Sci Med Sci. 2020; 4: 97-103.
  16.  Addetia A, Xie H, Roychoudhury P, Shrestha L, Loprieno M, Huang ML, et al. Identification of multiple large deletions in ORF7a resulting in in-frame gene fusions in clinical SARSCoV-2 isolates. J Clin Virol.2020; 129:104523.
  17. Al-Rashedi NAM, Alburkat H, Hadi AO, Munahi MG, Jasim A, Hameed A, et al. High prevalence of an alpha variant lineage with a premature stop codon in ORF7a in Iraq, winter 2020-2021. PLoS One. 2022; 17: e0267295.  
  18. Hachim A, Gu H, Kavian O, Mori M, Kwan MYW, Chan WH, et al. SARS-CoV-2 accessory proteins reveal distinct serological signatures in children. Nat Commun. 2022; 13: 2951.
  19. Chakraborty AK. Dynamics of SARS-CoV-2 ORF7a Gene Deletions and Fate of Downstream ORF7b and ORF8 Genes Expression. SunText Rev Biotechnol. 2022; 3: 142.
  20. Chakraborty AK. SARS-CoV-2 ORF8 gene CAA=TAA and AAA=TAA termination codon mutations found mostly in B.1.1.7 variant was independent of popular L84S mutations. Int J Clini Med Edu Res. 2022; 1: 192-208.
  21.  Zhu FC, Guan XH, Li YH, Huang JY, Jiang T, Hou LH, et al. Immunogenicity and safety of a recombinant adenovirus type-5-vectored COVID-19 vaccine in healthy adults aged 18 years or older: a randomised, double-blind, placebo-controlled, phase 2 trial. Lancet. 2020; 396: 479-488.
  22. Chakraborty AK. Hyper-variable Spike protein of Omicron corona virus and its differences with Alpha and Delta variants: Prospects of RT-PCR and new vaccine. J Emerg Dis Virol. 2022; 7:1-13.
  23. Meng B, Kemp SA, Papa G, Datir R, Marelli S, Lytras S, et al. Recurrent emergence of SARS-CoV-2 Spike deletion H69/V70 and its role in the Alpha variant B.1.1.7. Cell Reports. 2021; 35: 109292.
  24. Guruprasad K. Geographical Distribution of Amino Acid Mutations in human SARS-CoV-2 Orf1ab polyprotein compared to the equivalent reference proteins from China. ChemRxiv. 2021.
  25. Liu Z, Zheng H, Lin H, Li M, Yuan R, Peng J, et al. Identification of Common Deletions in the Spike Protein of Severe Acute Respiratory Syndrome Coronavirus 2. J Virol. 2020; 94: e00790-20.
  26. Khalid M, Mutphy D, Shoai M, George-William JN, Al-ebini Y. Geographical distribution of host’s specific SARS-CoV-2 mutations in the early phase of the COVID-19 pandemic. Gene. 2023; 51: 147020.
  27. Benedetti F, Snyder GA, Giovanetti M, Angeletti S, Gallo RC, Ciccozzzi M, et al. Emerging of a SARS-CoV-2 viral strain with a deletion in nsp1. J Transl Med. 2020; 18: 329.  
  28. Clark LK, Green TJ, Petit CM. Structure of Non-structural Protein 1 from SARS-CoV-2. J Virol. 2021; 95: e02019-20.
  29. Frieman MB, Baric RS, Orr M, Wathelet MG. Severe acute respiratory syndrome coronavirus evades antiviral signalling: role of nsp1 and rational design of an attenuated strain. J Virol. 2007; 81: 11620-11633.
  30. Kumar A, Ishida R, Strilets T, Cole J, Fayad N, Hobman TC, et al. SARS-CoV-2 Nonstructural Protein 1 Inhibits the Interferon response by causing depletion of key host signaling factors. J Virol. 2021; 95: e0026621. 
  31. Fisher T, Gluck A, Narayanan K, Kuroda M, Nachshon A, Hsu JC, et al. Parsing the role of NSP1 in SARS-CoV-2 infection. Cell Rep. 2022; 39: 110954.
  32. Zhao K, Ke Z, Hu H, Liu Y, Li A, Hua R, et al. Structural Basis and Function of the N Terminus of SARS-CoV-2 Nonstructural Protein 1. Microbiol Spectr. 2021; 9: e0016921.
  33. Shen Z, Zhang G, Yang Y, Li M, Yang S, Peng G. Lysine 164 is critical for SARS-CoV-2 Nsp1 inhibition of host gene expression. J Gen Virol. 2021.
  34. Schubert K, Karousis ED, Jomaa A, Scaiola A, Echeverria B, Ban N, et al. SARS-CoV-2 Nsp1 binds the ribosomal mRNA channel to inhibit translation. Nat Struct Mol Biol. 2020; 27: 959-966.
  35. Thoms M, Buschauer R, Ameismeier M, Koepke L, Denk T, Kratzat H, et al. Structural basis for translational shutdown and immune evasion by the Nsp1 protein of SARS-CoV-2. Sci. 2020; 369: 1249-1255.
  36. Huang C, Lokugamage KG, Rozovics JM, Narayanan K, Semler BL, Makino S, et al.  SARS coronavirus nsp1 protein induces template-dependent endonucleolytic cleavage of mRNAs: viral mRNAs are resistant to nsp1-induced RNA cleavage. PLoS Pathog. 2011; 7: e1002433.
  37. Pan Z, Feng Y, Wang Z, Lei Z, Han Q, Zhang J. MERS-CoV nsp1 impairs the cellular metabolic processes by selectively downregulating mRNAs in a novel-granules. Virulence, 2022; 13: 355-369.
  38. Lee MJ, Leong MW, Rustagi A, Beck A, Zeng L, Holmes S, et al. SARS-CoV-2 escapes direct NK cell killing through Nsp1-mediated downregulation of ligands for NKG2D. Cell Rep. 2022; 41: 111892.
  39. Lapointe CP, Grosely R, Johnson AG, Wang J, Fernández IS, Puglisi JD. Dynamic competition between SARS-CoV-2 NSP1 and mRNA on the human ribosome inhibits translation initiation. Proc Natl Acad Sci USA, 2021; 118: e2017715118.
  40. Shuvalov A, Shuvalova E, Biziaev N, Sokolova E, Evmenov K, Matrosova, et al. Nsp1 of SARS-CoV-2 stimulates host translation termination. RNA Biol. 2021; 18: 804-817.
  41. Lokugamage KG, Narayanan K, Huang C, Makino S. Severe acute respiratory syndrome coronavirus protein nsp1 is a novel eukaryotic translation inhibitor that represses multiple steps of translation initiation. J Virol. 2012; 86: 13598-13608.
  42. Mendez AS, Ly M, González-Sánchez AM, et al. The N-terminal domain of SARS-CoV-2 nsp1 plays key roles in suppression of cellular gene expression and preservation of viral gene expression. Cell Rep. 2021; 37: 109841.
  43. Yuan S, Peng L, Park JJ, Hu Y, Devarkar SC, Dong MB, et al. Nonstructural Protein 1 of SARS-CoV-2 Is a Potent Pathogenicity Factor Redirecting Host Protein Synthesis Machinery toward Viral RNA. Mol Cell, 2020; 80: 1055-1066.e6.
  44.  Zhang K, Miorin L, Makio T, Dehghan I,  Gao S, Xie Y, et al. Nsp1 protein of SARS-CoV-2 disrupts the mRNA export machinery to inhibit host gene expression. Sci Adv. 2021; 7: eabe7386.
  45. Lin JW, Tang C, Wei HC, Du B, Chen C, Wang M, et al. Genomic monitoring of SARS-CoV-2 uncovers a Nsp1 deletion variant that modulates type I interferon response. Cell Host Microbe. 2021; 29: 489-502.e8.
  46. Zanchi FB, Mariúba LA, Nascimento V. Structural analysis of SARS-Cov-2 nonstructural protein 1 polymorphisms found in the Brazilian Amazon. Exp Biol Med (Maywood). 2021; 246: 2332-2337.
  47. Sosnowski P, Tidu A, Eriani G, Martin F. Correlated sequence signatures are present within the genomic 5'UTR RNA and NSP1 protein in coronaviruses. RNA, 2022; 28: 729-741.
  48. Yang Y, Jiang XT, Zhang T. Evaluation of a Hybrid Approach using UBLAST and BLASTX for Metagenomic Sequences Annotation of specific functional genes. PLoS One. 2014; 9: e110947.
  49. Corpet F. Multiple sequence alignment with hierarchical clustering" Nucl. Acids Res. 1988; 16: 10881-10890.
  50. Wallace IM, Blackshields G, Higgins DG. Multiple sequence alignments. Curr Opin Struct Biol. 2005; 15: 261-266.
  51. Sievers F, Wilm A, Dineen DG, Gibson TJ, Karplus K, Li W, et al. Fast, scalable generation of high-quality protein multiple sequence alignments using Clustal Omega. Mol Sys Bio. 2011; 7: 539.  
  52. Altschul SF, Gish W, Miller W, Myers EM, Lipman DJ. Basic local alignment search tool. J Mol Biol. 1990; 215: 403-410.
  53. Roy A, Kucukural A, Zhang Y. I-TASSER: a unified platform for automated protein structure and function prediction. Nat Protoc. 2010; 5: 725-738.
  54. Chou PY, Fasman GD. Prediction of protein conformation. Biochemistry, 1974; 13: 222-245.
  55. Bienert S, Waterhouse A, de Beer TAP, et al. The SWISS-MODEL repository-new features and functionality. Nucl Acid Res. 2017; 45: D313-D319.
  56. Kalyaanamoorthy S, Minh BQ, Wong TKF, von Haeseler A, Jermiin LS. ModelFinder: fast model selection for accurate phylogenetic estimates. Nat. Methods, 2017; 14: 587-589.
  57. Katoh K, Standley DM. MAFFT multiple sequence alignment software version 7: improvements in performance and usability. Mol Biol Evol. 2013; 30: 772-780.
  58. Khan MI, Khan ZA, Baig MH, Ahmad I, Farouk AE, Song JJ, et al. Comparative genome analysis of novel coronavirus (SARS-CoV-2) from different geographical locations and the effect of mutations on major target proteins: An in-silico insight. PLoS One. 2020; 15: e0238344.
  59. Banerjee S, Seal S, Dey R, Mondal KK, Bhattacharjee P. Mutational spectra of SARS?CoV?2 orf1ab polyprotein and signature mutations in the United States of America. J Med Virol. 2021; 93: 1428-1435.
  60. Xia H, Cao Z, Xie X, Zhang X, Wang H, Rajsbaum R, et al. Evasion of Type I Interferon by SARS-CoV-2. Cell Rep. 2020; 33: 108234.
  61. Cao C, He L, Tian Y, Qin Y, Sun H, Ding W, et al. Molecular epidemiology analysis of early variants of SARS-CoV-2 reveals the potential impact of mutations P504L and Y541C (NSP13) in the clinical COVID-19 outcomes. Infect Genet Evol.  2021; 104831.
  62. Chakraborty AK. A method of identification of SARS-CoV-2 variant using NCBI BLAST-2 100% Homology Search with specific oligonucleotides selected at the deletion boundaries of S, N, ORF7a, ORF8 and ORF1ab proteins. Research Square. 2022.
  63. Duchene S, Featherstone L, Haritopoulou-Sinanidou M, Rambaut A, Lemey P, Baele G. Temporal signal and the phylodynamic threshold of SARS-CoV-2. Virus Evol. 2020; 6: veaa061.
  64. Gordon DE, Gwendolyn MJ, Bouhaddou M, Xu J, Obernier K, White KM, et al. A SARS-CoV-2 protein interaction map reveals targets for drug repurposing. Nature, 2020; 583: 459-468.
  65. Gao K, Wang R, Chen J, Cheng L, Frishcosy J, Huzumi Y, et al. Methodology-Centered Review of Molecular Modeling, Simulation, and Prediction of SARS-CoV-2. Chem Rev. 12022; 22: 11287-11368.
Reach Us